Stem-loop sequence bdi-MIR7759

AccessionMI0025379 (change log)
DescriptionBrachypodium distachyon miR7759 stem-loop
Stem-loop
   --     caua c                  g  ua       g   c   u    a         -        accgcaaaagcgccauucugguugauaugccuucugauuucugggaaugggagucagaauacaugggauauuugaaguca 
5'   ggaca    g agccacgucggcauaagc ag  ccgcggg uug ugu gugc uucucaggg uuuuuuuu                                                                                a
     |||||    | |||||||||||||||||| ||  ||||||| ||| ||| |||| ||||||||| ||||||||                                                                                 
3'   ccugu    c ucggugcagccguauucg uc  ggugccc aac aca cacg aagaguccc aaaaaaaa                                                                                u
   aa     acac a                  g  cc       -   u   c    a         c        gcguuuucacuacaagaagagaggaacacgaggguauuugggaaguagagguccuaugucuuugguuuaaccuugggguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 47694041-47694348 [+]
intergenic
Database links

Mature sequence bdi-miR7759-5p

Accession MIMAT0030264
Sequence

11 - 

cagccacgucggcauaagcgag

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7759-3p

Accession MIMAT0030265
Sequence

277 - 

ggcuuaugccgacguggcuac

 - 297

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).