Stem-loop sequence bdi-MIR7760

AccessionMI0025380 (change log)
DescriptionBrachypodium distachyon miR7760 stem-loop
Stem-loop
   aggucuagugag  g u     a    a  gaa g      -  agc     g      -  agg   g  --g        g -g    g  g u 
5'             ga u gacgc gcgg ca   u gagcaa gc   ucaug cgccgu ca   ucg cc   ucucccac a  uccg cg c g
               || | ||||| |||| ||   | |||||| ||   ||||| |||||| ||   ||| ||   |||||||| |  |||| || |  
3'             uu g uugcg uguc gu   g cucguu cg   agugc gcggcg gu   agu gg   agagggug u  aggu gc g g
   ---------cgg  g u     g    -  -ga g      u  -gc     a      u  -ga   -  aca        g gg    g  g c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 44260861-44261035 [+]
intergenic
Database links

Mature sequence bdi-miR7760-5p

Accession MIMAT0030266
Sequence

22 - 

cagcggacagaauggagcaagcag

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7760-3p

Accession MIMAT0030267
Sequence

142 - 

ggcuuugcucggagugcuguggc

 - 164

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).