Stem-loop sequence bdi-MIR7761

AccessionMI0025381 (change log)
DescriptionBrachypodium distachyon miR7761 stem-loop
Stem-loop
   augcuuucuga            u          cc     uuc      g      a ag   ug g  ag            ---         a    ---g  c  a    a           uu       -----------              c               cgggccggcccaaccgcucacaacca 
5'            cguuguugccag gccgucucuu  ucaag   uggugg gacagg u  gag  a ug  aauggugguggu   gguggcagc gcgg    au ga aggg guuaggguugg  ugggggc           uuauauguuaaagu augggcagguugggc                          c
              |||||||||||| ||||||||||  |||||   |||||| |||||| |  |||  | ||  ||||||||||||   ||||||||| ||||    || || |||| |||||||||||  |||||||           |||||||||||||| |||||||||||||||                           
3'            gcaacggcgguc cggcagagaa  aguuc   accacc cugucc a  cuc  u ac  uuaccaccaccg   ccaccgucg cgcc    ug cu uccc caaucccaacc  acccccg           aauguauaauuuca uaccuguccaacccg                          u
   --------gga            u          cu     uca      g      c cu   cu g  cu            ccg         c    guca  a  c    c           cc       cccccgccccu              a               aucucauauuaaagucaccaauagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 4507481-4507863 [-]
intergenic
Database links

Mature sequence bdi-miR7761-5p

Accession MIMAT0030268
Sequence

21 - 

cagugccgucucuuccucaaguuc

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7761-3p

Accession MIMAT0030269
Sequence

350 - 

ucuugaucaagagacggcucuggc

 - 373

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).