Stem-loop sequence bdi-MIR7763

AccessionMI0025383 (change log)
DescriptionBrachypodium distachyon miR7763 stem-loop
Stem-loop
   -   cuu  gc                              -  uc        
5'  caa   gg  ugcaaucuugaugugcggggauagauauuc ca  uugagag 
    |||   ||  |||||||||||||||||||||||||||||| ||  |||||| g
3'  guu   cc  acguuagaacugcaugcccuuaucuauaag gu  aauuuua 
   c   agu  ua                              a  -c        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 4505087-4505190 [+]
intergenic
Database links

Mature sequence bdi-miR7763-5p

Accession MIMAT0030272
Sequence

14 - 

aaucuugaugugcggggauag

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7763-3p

Accession MIMAT0030273
Sequence

72 - 

auucccguacgucaagauugc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).