Stem-loop sequence bdi-MIR7764

AccessionMI0025384 (change log)
DescriptionBrachypodium distachyon miR7764 stem-loop
Stem-loop
   ---a               -   -       a         ccaaagaaaaucucca 
5'     uuugcggcccauaac cua gaucugu ucaaaaggc                c
       ||||||||||||||| ||| ||||||| |||||||||                 
3'     aaacguuggguauug ggu cuagaua aguuuuccg                a
   gucc               c   u       a         cuccuauaaucuauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 5125732-5125842 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7764
bdi-MIR77644: 5125732-5125842 [+]
bdi-MIR77504: 5126959-5127388 [+]
Database links

Mature sequence bdi-miR7764-5p

Accession MIMAT0030274
Sequence

11 - 

cauaaccuagaucuguauca

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7764-3p

Accession MIMAT0030275
Sequence

79 - 

aaauagaucuuggcguuauggg

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).