Stem-loop sequence bdi-MIR7708b

AccessionMI0025385 (change log)
DescriptionBrachypodium distachyon miR7708b stem-loop
Gene family MIPF0001801; MIR7708
Stem-loop
   -        g                  a                 c      c          a    gaccuuuuugucugcucaugacauguuuuuuagcuugagauggcuguuuugaauaguuuuuuucucuaaugaaaauuuucccugcucaugagucgaacaaaauaauuacugcguuccucgaccuuauauaugggaugacgggugaccuuuugggauacugac 
5'  uugcccag accauuacaauucuuggg cauuugcugaaacacac gcccgu caaaaaggga aguu                                                                                                                                                                  c
    |||||||| |||||||||||||||||| ||||||||||||||||| |||||| |||||||||| ||||                                                                                                                                                                  c
3'  aacggguc ugguaauguuaagagccc guaaacggcuuugugug cgggca guuuuucccu ucaa                                                                                                                                                                  a
   a        a                  g                 a      u          c    agaaguaaauaaauuacuuauguggaaaugaaaaggaacuccuacagcggagaaaccugguauaguuuaguucgucaugaaaaggcacggauaugaguuaggcuuucgcuagucgaacgaggucuaagaguuuucacuuguuguuuuuucuuuucaucguga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 49383462-49383925 [-]
intergenic
Database links

Mature sequence bdi-miR7708b-5p

Accession MIMAT0030276
Sequence

12 - 

cauuacaauucuugggacauuugc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7708b-3p

Accession MIMAT0030277
Sequence

431 - 

aaauggcccgagaauuguaauggu

 - 454

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).