Stem-loop sequence bdi-MIR7765

AccessionMI0025386 (change log)
DescriptionBrachypodium distachyon miR7765 stem-loop
Stem-loop
   ---   u      -                 aag   -c     a     a                     ca  uu   -uaga       accaauaaguguugacacguguccuguauaguuggcccagacaguuucuggguuuuuuuucugaaaagaaaacccccugugauuauugcgcaucccgcucaccuccuggggcgugacuagcagguccggcacgcgcacugccuccguccccggcggcaacggcuugca 
5'    uug gaggug gagcauuuuaguccaac   uug  aaaug gaaaa cuaguccuagaaguugagaug  ga  ggu     gguccaa                                                                                                                                                                        c
      ||| |||||| |||||||||||||||||   |||  ||||| ||||| |||||||||||||||||||||  ||  |||     |||||||                                                                                                                                                                        g
3'    aac cuccac cucguaaaaucagguug   aac  uuuac cuuuu gaucaggaucuucaacucuac  cu  ucg     ucagguu                                                                                                                                                                        a
   uug   u      a                 aag   au     c     g                     ac  --   uaaaa       aaucaggcuuaaccuguccaccgucguuguacuucagugcagccugggcaucuuuaaagcguuuuucccgggggccuguccuuacuaaauacguguacaggggccaugugcggcucucagggcagccgacgagccaaaggcaacugaugcugcccgucccacaacucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 47611750-47612266 [+]
intergenic
Database links

Mature sequence bdi-miR7765-5p

Accession MIMAT0030278
Sequence

14 - 

cauuuuaguccaacaaguugcaa

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7765-3p

Accession MIMAT0030279
Sequence

478 - 

uuacaagaaguuggacuaaaaugc

 - 501

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).