Stem-loop sequence bdi-MIR7766

AccessionMI0025387 (change log)
DescriptionBrachypodium distachyon miR7766 stem-loop
Stem-loop
          g  a  aac   -g           g     aaccaacugggcuuuagucggcuugggccaggccg 
5' ccuggcc aa cc   ugg  ccagucggccu ggcua                                   a
   ||||||| || ||   |||  ||||||||||| |||||                                   c
3' ggacugg uu gg   auc  ggucagucgga ccggu                                   u
          g  c  cga   ag           g     ccagcggacgagucgggcgccccgggggugauccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 70862451-70862598 [-]
intergenic
Database links

Mature sequence bdi-miR7766-5p

Accession MIMAT0030280
Sequence

12 - 

ccaacugggccagucggccugggc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7766-3p

Accession MIMAT0030281
Sequence

115 - 

cgaggcugacugggacuaagcggc

 - 138

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).