Stem-loop sequence bdi-MIR7768a

AccessionMI0025389 (change log)
DescriptionBrachypodium distachyon miR7768a stem-loop
Gene family MIPF0001761; MIR7768
Stem-loop
   -c     u                     c      cagcgcuccccuucgc 
5'   uccgc gcgcucccggucgaggacggc ccgccg                g
     ||||| ||||||||||||||||||||| ||||||                c
3'   aggcg cgcgagggccagcuccugccg ggcggc                u
   ac     c                     c      ggcggacgcaucaagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 1447437-1447542 [-]
intergenic
Database links

Mature sequence bdi-miR7768a-5p

Accession MIMAT0030284
Sequence

13 - 

cccggucgaggacggccccgc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7768a-3p

Accession MIMAT0030285
Sequence

74 - 

cggcgccguccucgaccgggag

 - 95

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).