Stem-loop sequence bdi-MIR7768b

AccessionMI0025390 (change log)
DescriptionBrachypodium distachyon miR7768b stem-loop
Gene family MIPF0001761; MIR7768
Stem-loop
   -c                           c       agcgcuccccuucgcgcuag 
5'   uccgcggcgcucccggucgaggacggc ccgccgc                    a
     ||||||||||||||||||||||||||| |||||||                     
3'   aggcgccgcgagggccagcuccugccg ggcggcg                    a
   gc                           c       gcggcggcggcgcacgcauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 21264994-21265108 [-]
intergenic
Database links

Mature sequence bdi-miR7768b-5p

Accession MIMAT0030286
Sequence

13 - 

cccggucgaggacggccccgc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7768b-3p

Accession MIMAT0030287
Sequence

83 - 

cggcgccguccucgaccgggag

 - 104

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).