Stem-loop sequence bdi-MIR7770

AccessionMI0025392 (change log)
DescriptionBrachypodium distachyon miR7770 stem-loop
Stem-loop
   aca           c     a                        -   cca   --  u u 
5'    gagaaccucuc uugaa gccugucuagacaagcuagauagu agu   gag  gu c c
      ||||||||||| ||||| |||||||||||||||||||||||| |||   |||  || | g
3'    cucuuggagag aacuu cgggcagaucuguucgaucuauca uca   cuc  ca g g
   uga           a     c                        a   caa   ga  c u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 7993933-7994056 [+]
intergenic
Database links

Mature sequence bdi-miR7770-5p

Accession MIMAT0030290
Sequence

14 - 

ccuugaaagccugucuagaca

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7770-3p

Accession MIMAT0030291
Sequence

93 - 

ucuagacgggccuucaaagag

 - 113

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).