Stem-loop sequence bdi-MIR7771

AccessionMI0025393 (change log)
DescriptionBrachypodium distachyon miR7771 stem-loop
Stem-loop
   -     c    au               c                c     ug   --a  uc    aa 
5'  uuugc gagg  uuacaacccuugacu cuauaguacacauucc gauau  aaa   ug  aagu  a
    ||||| ||||  ||||||||||||||| |||||||||||||||| |||||  |||   ||  ||||   
3'  aaacg uucc  aauguugggaacuga gauaucauguguaagg uuaug  uuu   au  uuua  u
   u     u    cg               a                u     gu   gaa  ga    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 65106389-65106525 [-]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7771
bdi-MIR77711: 65106389-65106525 [-]
bdi-MIR77441: 65104738-65105027 [-]
Database links

Mature sequence bdi-miR7771-5p

Accession MIMAT0030292
Sequence

20 - 

ccuugacuccuauaguacacauuc

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7771-3p

Accession MIMAT0030293
Sequence

96 - 

auguguacuauagaagucaagggu

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).