Stem-loop sequence bdi-MIR7773

AccessionMI0025395 (change log)
DescriptionBrachypodium distachyon miR7773 stem-loop
Stem-loop
   aagaaca    c   a    g    -a                   cuu 
5'        ugga ggc uacg guca  cgaaggaaaaauucaggcu   g
          |||| ||| |||| ||||  |||||||||||||||||||    
3'        accu ccg augc cagu  gcuuccuuuuuaaguccgg   a
   ------a    a   c    a    cg                   uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 64869277-64869369 [-]
intergenic
Database links

Mature sequence bdi-miR7773-5p

Accession MIMAT0030296
Sequence

19 - 

cgggucaacgaaggaaaaauu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7773-3p

Accession MIMAT0030297
Sequence

62 - 

uuuuuccuucggcugacacgu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).