Stem-loop sequence bdi-MIR7775

AccessionMI0025397 (change log)
DescriptionBrachypodium distachyon miR7775 stem-loop
Stem-loop
   ---       u       -   au     a    c       -au       uu g      cua 
5'    acaaaau aaaccgg uuu  ucuga gcac aguguuu   uucuaua  a aggugc   a
      ||||||| ||||||| |||  ||||| |||| |||||||   |||||||  | ||||||    
3'    uguuuua uuuggcc aaa  agauu cgug ucacgaa   aagauau  u uccacg   u
   acg       -       c   ac     -    a       cac       cc g      aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 38334085-38334209 [+]
intergenic
Database links

Mature sequence bdi-miR7775-5p

Accession MIMAT0030300
Sequence

11 - 

accgguuuauucugaagcaccagu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7775-3p

Accession MIMAT0030301
Sequence

91 - 

cuagugcuuagacaaaacccgguu

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).