Stem-loop sequence bdi-MIR7776

AccessionMI0025398 (change log)
DescriptionBrachypodium distachyon miR7776 stem-loop
Stem-loop
   cc        a c                 -gga                       g    c   aa   agu 
5'   ccaucaua c uugcccucugauaucuu    cauucaacucauuauuaaugagg acaa aac  uga   u
     |||||||| | |||||||||||||||||    ||||||||||||||||||||||| |||| |||  |||    
3'   gguaguau g aacgggagacuauagaa    guaaguuggguaauaguugcucc uguu uug  gcu   a
   -a        c c                 acgc                       -    a   aa   gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 54086906-54087052 [-]
intergenic
Database links

Mature sequence bdi-miR7776-5p.1

Accession MIMAT0030302
Sequence

13 - 

cuugcccucugauaucuugg

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7776-5p.2

Accession MIMAT0030303
Sequence

33 - 

acauucaacucauuauuaaug

 - 53

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7776-3p.2

Accession MIMAT0030304
Sequence

97 - 

uugauaauggguugaaugcgc

 - 117

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7776-3p.1

Accession MIMAT0030305
Sequence

118 - 

aaagauaucagagggcaacg

 - 137

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).