Stem-loop sequence bdi-MIR7777

AccessionMI0025399 (change log)
DescriptionBrachypodium distachyon miR7777 stem-loop
Stem-loop
   ---     a  ggu      g       a    u    cu    a        g    u    u        -u   u 
5'    ugugu gc   aucuuu guugggu gaac accu  gaca acaccauc caac gcag auaucaug  uau a
      ||||| ||   |||||| ||||||| |||| ||||  |||| |||||||| |||| |||| ||||||||  |||  
3'    acaca ug   uagaag caaccca cuug ugga  uugu ugugguag guug uguc uguaguac  aug u
   uau     g  ---      a       c    u    ag    c        a    u    c        cc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 65552800-65552950 [-]
intergenic
Database links

Mature sequence bdi-miR7777-5p.1

Accession MIMAT0030306
Sequence

14 - 

cuuugguuggguagaacuacc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7777-5p.2

Accession MIMAT0030307
Sequence

35 - 

ucugacaaacaccaucgcaac

 - 55

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7777-3p.2

Accession MIMAT0030308
Sequence

99 - 

ugagauggugucuguugaagg

 - 119

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7777-3p.1

Accession MIMAT0030309
Sequence

120 - 

uuguuccacccaacagaagau

 - 140

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).