Stem-loop sequence bdi-MIR7778

AccessionMI0025400 (change log)
DescriptionBrachypodium distachyon miR7778 stem-loop
Stem-loop
   --c   g    gga ca   --u    g  u              -ggccuc     c  c    ccua  c       
5'    gac gcag   g  ucg   gucg cg gcgcggcggccaug       gucgc cu cucg    ga gcccgg 
      ||| ||||   |  |||   |||| || ||||||||||||||       ||||| || ||||    || ||||| u
3'    cug uguc   c  ggc   cagc gc cgcgucgccggugc       uagcg ga gagc    cu cgggcc 
   ugu   g    gag -a   uuu    -  -              auuuuau     c  a    --ca  c       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 18369831-18369977 [+]
intergenic
Database links

Mature sequence bdi-miR7778-5p

Accession MIMAT0030310
Sequence

11 - 

gagcaucgugucggcgugcgcggc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7778-3p

Accession MIMAT0030311
Sequence

114 - 

cugcgccgcgacuuucggacgag

 - 136

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).