Stem-loop sequence bdi-MIR7779

AccessionMI0025401 (change log)
DescriptionBrachypodium distachyon miR7779 stem-loop
Stem-loop
   ---g   a  g  g     -auugu    ca        ccc       --c  ucggccagaucaucggagaccuccuuaaucuuggugcaauggucaaugauggagcccuugcacgaugcgaugaaguuugugcaacgucuccacgauggccuaggccau 
5'     ggc gc ac agguc      caga  ugggaagu   acgucag   cc                                                                                                            a
       ||| || || |||||      ||||  ||||||||   |||||||   ||                                                                                                            g
3'     ucg cg ug ucuag      gucu  gcucuuca   uguaguc   gg                                                                                                            g
   guga   -  a  a     ccagau    -a        uac       cuu  uguaacuggaguuccuguuguuaaccgccuaguagcuaaacaagcacuuaggugaggugucaaaggaggaggcagaagccguacuaguaccugguuuuccgcugguaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 38848227-38848545 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7779
bdi-MIR77331: 38847604-38848027 [+]
bdi-MIR77791: 38848227-38848545 [+]
Database links

Mature sequence bdi-miR7779-5p

Accession MIMAT0030312
Sequence

11 - 

gaggucauugucagacaugggaag

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7779-3p

Accession MIMAT0030313
Sequence

285 - 

uucucgaucuguagaccgaucuag

 - 308

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).