Stem-loop sequence bdi-MIR7780

AccessionMI0025402 (change log)
DescriptionBrachypodium distachyon miR7780 stem-loop
Stem-loop
   ugggagccccaugaauga              -aa     ug cc         uag 
5'                   gggagaagagggau   uuuag  g  uuccuacuu   u
                     ||||||||||||||   |||||  |  |||||||||   g
3'                   ucuucuuuuuuuug   aaguc  u  agggaugaa   g
   ----------------ga              cag     gu cc         uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 68651831-68651930 [-]
intergenic
Database links

Mature sequence bdi-miR7780-5p

Accession MIMAT0030314
Sequence

30 - 

gauaauuuaguggccuuccuacuu

 - 53

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7780-3p

Accession MIMAT0030315
Sequence

65 - 

guagggaccuugcugaagacguuu

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).