Stem-loop sequence bdi-MIR7781

AccessionMI0025403 (change log)
DescriptionBrachypodium distachyon miR7781 stem-loop
Stem-loop
   ------                                g          c                           u       c       uc    a    gcau   a  -u c             ---u    uag 
5'       uaugaugaggaaacgaauuugauuuuucugac acggacaugg ugauuuuaugguccggccggagacaau cagcuca aaguaug  uaga uaga    gag ag  g uggaccuguugug    ugua   u
         |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||||||| |||||||  |||| ||||    ||| ||  | |||||||||||||    ||||    
3'       augcuacuccuuugcuuaaacuaaaaagacug ugucuguacc acuaaaauaccagguuggccucuguua gucgagu uucauac  auuu aucu    cuc uc  c accuggacaauau    gcgu   a
   gcuccc                                a          c                           c       c       cu    c    gauc   c  cu a             gcuu    uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 6987696-6987971 [+]
intergenic
Clustered miRNAs
< 10kb from bdi-MIR7781
bdi-MIR77323: 6980920-6981024 [+]
bdi-MIR77813: 6987696-6987971 [+]
Database links

Mature sequence bdi-miR7781-5p

Accession MIMAT0030316
Sequence

21 - 

gauuuuucugacgacggacauggc

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7781-3p

Accession MIMAT0030317
Sequence

229 - 

caugucuguagucagaaaaaucaa

 - 252

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).