Stem-loop sequence bdi-MIR7782

AccessionMI0025404 (change log)
DescriptionBrachypodium distachyon miR7782 stem-loop
Stem-loop
   -u   c   u     a                    a  ug     u -ug   ---     g  a 
5'   cau aag auauu cgcggcaugguauuagagca gu  ccaaa c   gcu   gccau ac a
     ||| ||| ||||| |||||||||||||||||||| ||  ||||| |   |||   ||||| || u
3'   gua uuu uauaa guguuguaccauagucucgu ca  gguuu g   ugg   uggua ug u
   ac   a   u     a                    c  gu     u uua   uag     g  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 30460954-30461083 [+]
intergenic
Database links

Mature sequence bdi-miR7782-5p

Accession MIMAT0030318
Sequence

17 - 

gcggcaugguauuagagcaaguug

 - 40

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence bdi-miR7782-3p

Accession MIMAT0030319
Sequence

92 - 

accugcucugauaccauguuguga

 - 115

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).
2
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).