Stem-loop sequence bdi-MIR7783

AccessionMI0025405 (change log)
DescriptionBrachypodium distachyon miR7783 stem-loop
Stem-loop
   ccaucgu   c  cu    g       u       ca          a      a   c    uccguuggguuauguucuuugguggaguuaaaug 
5'        gaa ug  gguc cgucuac ugguauc  agcuuaugau ucuguu ugc ugau                                  u
          ||| ||  |||| ||||||| |||||||  |||||||||| |||||| ||| ||||                                  c
3'        cuu ac  uuag guaggug accauag  ucgaauacua agacaa aug acug                                  a
   -------   a  ag    a       u       uc          g      c   u    gcggaagaucaccucccuucguaaaccgguaacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 14480283-14480472 [-]
intergenic
Database links

Mature sequence bdi-miR7783-5p

Accession MIMAT0030320
Sequence

20 - 

gcgucuacuugguauccaagcuua

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7783-3p

Accession MIMAT0030321
Sequence

157 - 

agcucugauaccauguggaugaga

 - 180

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).