Stem-loop sequence bdi-MIR7786

AccessionMI0025409 (change log)
DescriptionBrachypodium distachyon miR7786 stem-loop
Stem-loop
   aucuaaccaau   ucug g     - u    g     -  c      cgcg g   ua 
5'            gug    u ucugu g cuau ucuau gu ugugca    u ugu  a
              |||    | ||||| | |||| ||||| || ||||||    | |||   
3'            cac    g agacg c gaug aggug ca acacgu    a acg  a
   -----aagcgu   -uaa g     g u    -     u  a      --ua g   uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 42351455-42351563 [-]
intergenic
Database links

Mature sequence bdi-miR7786-5p

Accession MIMAT0030328
Sequence

26 - 

gucuaugucuaugucugugcacgc

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7786-3p

Accession MIMAT0030329
Sequence

69 - 

ugcacaaacuguggaguagucggc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).