Stem-loop sequence bdi-MIR7787

AccessionMI0025410 (change log)
DescriptionBrachypodium distachyon miR7787 stem-loop
Stem-loop
   ---g uu             uc    -aga      ggaa g     guuuua     gga 
5'     g  uggucugugcucg  caca    gaagca    u gucca      ggaga   a
       |  |||||||||||||  ||||    ||||||    | |||||      |||||    
3'     c  accgggcacgggu  gugu    cuucgu    g caggu      ccucu   g
   ccua uc             uc    cugg      ---- g     ----aa     aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 39152783-39152894 [+]
intergenic
Database links

Mature sequence bdi-miR7787-5p

Accession MIMAT0030330
Sequence

11 - 

gugcucguccacaagagaagcagg

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7787-3p

Accession MIMAT0030331
Sequence

77 - 

ugcuucggucugugcuugggcacg

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).