Stem-loop sequence hhi-mir-7790

AccessionMI0025413 (change log)
DescriptionHippoglossus hippoglossus miR-7790 stem-loop
Stem-loop
   uua    -     g       ga      auuguauca         c 
5'    uuuc cuacu uuuccuu  uuucuu         ccaucuagc c
      |||| ||||| |||||||  ||||||         |||||||||  
3'    agag gauga aaaggag  aaagaa         gguggguug u
   -aa    a     a       --      ---------         g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-7790

Accession MIMAT0030334
Sequence

57 - 

uggaagaaagaggaaaaagua

 - 77

Get sequence
Evidence experimental; SOLiD [1]

References

1