Stem-loop sequence hhi-mir-723

AccessionMI0025414 (change log)
DescriptionHippoglossus hippoglossus miR-723 stem-loop
Gene family MIPF0001831; mir-723
Stem-loop
   g    c      ag    u    -a      ua      uu 
5'  ggca ggauaa  gcag uuug  ugaugu  cuucuu  a
    |||| ||||||  |||| ||||  ||||||  ||||||  u
3'  ucgu ccuauu  uguc aaau  acuaca  gaagaa  u
   u    u      cg    u    ag      --      uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-723

Accession MIMAT0030335
Sequence

61 - 

aaaucugugcuuauccuugcuu

 - 82

Get sequence
Evidence experimental; SOLiD [1]

References

1