Stem-loop sequence hhi-mir-430a-1

AccessionMI0025420 (change log)
DescriptionHippoglossus hippoglossus miR-430a-1 stem-loop
Gene family MIPF0000003; mir-430
Literature search

2 open access papers mention hhi-mir-430a-1
(8 sentences)

Stem-loop
   ---uuu    c            u   -ca     ca   uga   u 
5'       auca caauauuacccu gca   agcac  acu   guu a
         |||| |||||||||||| |||   |||||  |||   ||| g
3'       uagu guuaugaugggg ugu   ucgug  uga   caa a
   aaacuu    a            u   uua     aa   ---   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-430a

Accession MIMAT0030341
Sequence

53 - 

uaagugcuauuuguugggguag

 - 74

Get sequence
Evidence experimental; SOLiD [1]

References

1