Stem-loop sequence hhi-let-7c

AccessionMI0025424 (change log)
DescriptionHippoglossus hippoglossus let-7c stem-loop
Gene family MIPF0000002; let-7
Stem-loop
           a      uu   g   u             uag    aca c 
5' augugugc uccggg  gag uag agguuguaugguu   aauu   c c
   |||||||| ||||||  ||| ||| |||||||||||||   ||||   |  
3' ugcacaug agguuc  uuc auc uccaacaugucaa   uuga   g u
           -      cu   g   u             ---    --g g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-let-7c

Accession MIMAT0030345
Sequence

17 - 

ugagguaguagguuguaugguu

 - 38

Get sequence
Evidence experimental; SOLiD [1]

References

1