Stem-loop sequence hhi-let-7j

AccessionMI0025425 (change log)
DescriptionHippoglossus hippoglossus let-7j stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ggucugagg    ug           ugagggucugugauu 
5'          uagu  uuuguacaguu               c
            ||||  |||||||||||               u
3'          guca  gaacaugucaa               g
   ---------    gu           ucgaggacauacccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-let-7j

Accession MIMAT0030346
Sequence

5 - 

ugagguaguuguuuguacaguu

 - 26

Get sequence
Evidence experimental; SOLiD [1]

References

1