Stem-loop sequence hhi-mir-1

AccessionMI0025426 (change log)
DescriptionHippoglossus hippoglossus miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention hhi-mir-1
(1 sentences)

Stem-loop
   aagau      -  u  ugc                a  --------     g 
5'      uaccuc cu gg   acauacuucuuuaugu cc        cauau a
        |||||| || ||   |||||||||||||||| ||        |||||  
3'      guggag gg cc   uguaugaagaaaugua gg        guaua a
   ---gc      u  u  uua                a  uaucgaua     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-1

Accession MIMAT0030347
Sequence

60 - 

uggaauguaaagaaguauguau

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1