Stem-loop sequence hhi-mir-129b

AccessionMI0025428 (change log)
DescriptionHippoglossus hippoglossus miR-129b stem-loop
Gene family MIPF0000073; mir-129
Stem-loop
   g   uu  ug   ---c      c   cu      g   uuc   ag 
5'  ucc  ug  ggu    uuuuug ggu  gggcuu cug   cua  g
    |||  ||  |||    |||||| |||  |||||| |||   |||   
3'  agg  ac  cua    aaaaac cca  uccgaa gac   gau  c
   -   uc  gu   augc      c   au      g   --c   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-129b-5p

Accession MIMAT0030349
Sequence

14 - 

cuuuuugcggucugggcuugcu

 - 35

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence hhi-miR-129b-3p

Accession MIMAT0030350
Sequence

54 - 

aggaagccuuaaccccaaaaa

 - 74

Get sequence
Evidence experimental; SOLiD [1]

References

1