Stem-loop sequence hhi-mir-187

AccessionMI0025434 (change log)
DescriptionHippoglossus hippoglossus miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop
   gugaccucucu   c gg   ag                      ccugcu 
5'            ggc g  cca  ggcugcaacacaggacaugggu      c
              ||| |  |||  ||||||||||||||||||||||      u
3'            ccg c  ggu  ccgacguuguguucugugcucg      c
   ---------gu   u ga   ga                      ccccuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-187

Accession MIMAT0030356
Sequence

63 - 

ucgugucuuguguugcagcc

 - 82

Get sequence
Evidence experimental; SOLiD [1]

References

1