Stem-loop sequence hhi-mir-196

AccessionMI0025435 (change log)
DescriptionHippoglossus hippoglossus miR-196 stem-loop
Gene family MIPF0000031; mir-196
Literature search

2 open access papers mention hhi-mir-196
(7 sentences)

Stem-loop
   gcgg    uu a      u       c  a      u   cu  a 
5'     acug  g gugguu agguagu uc uguugu ggg  aa u
       ||||  | |||||| ||||||| || |||||| |||  || u
3'     ugac  c cauuag uccguca ag acaaca ccc  uu a
   ---a    -u -      u       a  c      -   uc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-196

Accession MIMAT0030357
Sequence

19 - 

uagguagucucauguuguuggg

 - 40

Get sequence
Evidence experimental; SOLiD [1]

References

1