Stem-loop sequence hhi-mir-199a

AccessionMI0025436 (change log)
DescriptionHippoglossus hippoglossus miR-199a stem-loop
Gene family MIPF0000040; mir-199
Literature search

1 open access papers mention hhi-mir-199a
(3 sentences)

Stem-loop
   --------------   c     c       u        c   u   gaag 
5'               gcc gccug ccagugu cagacuac ugu cag    u
                 ||| ||||| ||||||| |||||||| ||| |||     
3'               cgg cggau gguuaca gucugaug aca guu    a
   gggcacgaaggggu   u     u       c        -   u   ggug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-199a

Accession MIMAT0030358
Sequence

10 - 

cccaguguucagacuaccuguuc

 - 32

Get sequence
Evidence experimental; SOLiD [1]

References

1