Stem-loop sequence hhi-mir-21

AccessionMI0025437 (change log)
DescriptionHippoglossus hippoglossus miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

1 open access papers mention hhi-mir-21
(1 sentences)

Stem-loop
   ----    cccg            u             g    u u 
5'     ccau    ucagcuagcuua cagacugguguug cugu g a
       ||||    |||||||||||| ||||||||||||| |||| | u
3'     ggug    agucggucgaau guuugaucacaac ggua c u
   uccg    ucga            -             -    c g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-21

Accession MIMAT0030359
Sequence

14 - 

uagcuuaucagacugguguuggc

 - 36

Get sequence
Evidence experimental; SOLiD [1]

References

1