Stem-loop sequence hhi-mir-430b-1

AccessionMI0025444 (change log)
DescriptionHippoglossus hippoglossus miR-430b-1 stem-loop
Gene family MIPF0000003; mir-430
Literature search

2 open access papers mention hhi-mir-430b-1
(8 sentences)

Stem-loop
   gaa       c    c        u    c    g    uuc 
5'    uccagcu agau accucaaa ggag cacu auga   u
      ||||||| |||| |||||||| |||| |||| ||||   c
3'    ggguugg ucug ugggguuu ucuu guga uacu   u
   -ua       u    u        c    c    a    ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-430b

Accession MIMAT0030363
Sequence

52 - 

uaagugcuucucuuugggguug

 - 73

Get sequence
Evidence experimental; SOLiD [1]

References

1