Stem-loop sequence hhi-mir-96

AccessionMI0025447 (change log)
DescriptionHippoglossus hippoglossus miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop
   --ug  c  u       ua    uauuu      -uu  uc 
5'     cc au uuggcac  gcac     uugcuu   gu  u
       || || |||||||  ||||     ||||||   ||   
3'     gg ua aaccgug  ugug     aacgag   ca  c
   agca  c  u       ca    -uacu      uuu  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hhi-miR-96

Accession MIMAT0030365
Sequence

8 - 

uuuggcacuagcacuauuuuugcu

 - 31

Get sequence
Evidence experimental; SOLiD [1]

References

1