Stem-loop sequence rgl-MIR7797a

AccessionMI0025450 (change log)
DescriptionRehmannia glutinosa miR7797a stem-loop
Stem-loop
   -------------------------acuaccccucugagguuugauuuugucaua             aauu   a     c 
5'                                                        auuuuuaggggcc    uua uauuu u
                                                          |||||||||||||    ||| |||||  
3'                                                        uaaaaguuuucgg    aau guaaa a
   uuuuuugggaacuccaaacuaaggcagaaauguaaaaagggaaguguucuuaucu             gggu   -     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7797a

Accession MIMAT0032238
Sequence

112 - 

aagacggaaucaaaccucaa

 - 131

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).