Stem-loop sequence rgl-MIR7798

AccessionMI0025451 (change log)
DescriptionRehmannia glutinosa miR7798 stem-loop
Stem-loop
   -                  aacuuaugcu   ag u            guagcagaugcgaaaaguuguugagaaucagaaaaccuaaagcacaucuccccugcuuuuagguucuacu 
5'  uaagggaguguuugcaaa          uuc  a gaagugauuauc                                                                      u
    ||||||||||||||||||          |||  | ||||||||||||                                                                       
3'  auucccucacaaacguuu          aag  u uuucacuaauag                                                                      a
   g                  --------au   cu c            ucgaaaaccgacuuuuuuucuucaaauaucacaaaaguuuacgguuaaaaacgaagauuaaauauauuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7798

Accession MIMAT0032239
Sequence

3 - 

agggaguguuugcaaaaacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).