Stem-loop sequence rgl-MIR7799

AccessionMI0025452 (change log)
DescriptionRehmannia glutinosa miR7799 stem-loop
Stem-loop
   ga                   uucucuuuucuacucu     c   -         ---a     cacg  ug 
5'   ugagaucucuuauuccauu                cuauu cau guauuggau    uaaga    ug  a
     |||||||||||||||||||                ||||| ||| |||||||||    |||||    ||   
3'   acucuagaggauaagguga                gauaa gua cauaaccua    guucu    ac  u
   ua                   ---------------u     a   a         guua     ----  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7799

Accession MIMAT0032240
Sequence

105 - 

aguggaauaggagaucucaa

 - 124

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).