Stem-loop sequence rgl-MIR7800

AccessionMI0025453 (change log)
DescriptionRehmannia glutinosa miR7800 stem-loop
Stem-loop
   -      c      u       c   a     -cu      gu      
5'  ccauaa uucuau uuugugu guu ugguc   aaaugg  aaguc 
    |||||| |||||| ||||||| ||| |||||   ||||||  |||| a
3'  gguauu aagaua aaacacg uaa accag   uuuacc  uuuau 
   g      c      c       u   a     aac      ac      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7800

Accession MIMAT0032241
Sequence

11 - 

uauuuuugugucguuaugguc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).