Stem-loop sequence rgl-MIR7801

AccessionMI0025454 (change log)
DescriptionRehmannia glutinosa miR7801 stem-loop
Stem-loop
   uu   a  -       a   a         - --a aa    ----    -cua   ac      ua 
5'   ucu uu ccaaacu ugu ucaucucgu c   g  uauu    augu    cac  caagug  u
     ||| || ||||||| ||| ||||||||| |   |  ||||    ||||    |||  ||||||  u
3'   aga aa gguuuga aca aguagagca g   c  auag    uacg    gug  guucac  g
   uu   a  u       c   a         u aag cc    aauu    ugcg   ca      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7801

Accession MIMAT0032242
Sequence

98 - 

uacgagaugaaacacaguuug

 - 118

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).