Stem-loop sequence rgl-MIR7802

AccessionMI0025455 (change log)
DescriptionRehmannia glutinosa miR7802 stem-loop
Stem-loop
   -   u    uua gg ---          u       aaaaaguga  cu    u 
5'  uag aagu   g  a   guguuugcaa cacuaaa         uu  caac u
    ||| ||||   |  |   |||||||||| |||||||         ||  |||| c
3'  guc uucg   c  u   uauaaacguu gugauuu         aa  guug c
   a   -    --g uu gac          u       gugaugaag  ag    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7802

Accession MIMAT0032243
Sequence

11 - 

agggaguguuugcaaucacuaaa

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).