Stem-loop sequence rgl-MIR7803a

AccessionMI0025456 (change log)
DescriptionRehmannia glutinosa miR7803a stem-loop
Stem-loop
   -                ua                  auuaccauaugannnnaaauuaccauaugaaaaaaccc 
5'  uauucuaccguacgga  auugacacguguauaaaa                                      a
    ||||||||||||||||  ||||||||||||||||||                                      g
3'  auaagguggcgugcuu  uaacugugcacauauuuu                                      a
   g                gc                  caauaguauaauuaaacuucguauuuaguacggauuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7803a

Accession MIMAT0032244
Sequence

11 - 

uacggauaauugacacguguaua

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).