Stem-loop sequence rgl-MIR7804

AccessionMI0025457 (change log)
DescriptionRehmannia glutinosa miR7804 stem-loop
Stem-loop
   --------------------------------------------------------------------aaagccaacua           -   a cg     c  auuu     c 
5'                                                                                gggguguucau cga u  aauuc ga    uucga u
                                                                                  ||||||||||| ||| |  ||||| ||    ||||| u
3'                                                                                uuuuacaagua gcu a  uuaag cu    aagcu c
   uaagccuuuagcucuuuaaguuaggcaaauuuaagcuaagcuuaauuagcuuaauccuagcuuaaagcuuaacuucaaa           a   - au     -  ----     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7804-5p

Accession MIMAT0032245
Sequence

11 - 

agggguguucaucgaaucgaauu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence rgl-miR7804-3p

Accession MIMAT0032246
Sequence

62 - 

uuuaaucgaaugaacauuuuaaa

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).