Stem-loop sequence rgl-MIR7805

AccessionMI0025458 (change log)
DescriptionRehmannia glutinosa miR7805 stem-loop
Stem-loop
   accuca                 -           ac 
5'       caccaaauuugguguag ugaauaguguu  a
         ||||||||||||||||| |||||||||||   
3'       gugguuuaaaccacauu acuuaucacaa  c
   ------                 u           ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7805-5p

Accession MIMAT0032247
Sequence

11 - 

aaauuugguguagugaauagu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence rgl-miR7805-3p

Accession MIMAT0032248
Sequence

46 - 

uauucauuuacaccaaauuugg

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).