Stem-loop sequence rgl-MIR7806

AccessionMI0025459 (change log)
DescriptionRehmannia glutinosa miR7806 stem-loop
Stem-loop
   uaaguauauguggaaucucauuuc         a               u  ggcauucuaa     ac 
5'                         gcuuaugug acauuuucuaaguga uu          auggg  g
                           ||||||||| ||||||||||||||| ||          |||||  a
3'                         cgaguacac uguagaagauucacu aa          uacuc  a
   -------------uuucgucacaa         c               c  --aaauaaaa     ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7806

Accession MIMAT0032249
Sequence

96 - 

uagaagauguccacaugagca

 - 116

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).