Stem-loop sequence rgl-MIR7807a

AccessionMI0025460 (change log)
DescriptionRehmannia glutinosa miR7807a stem-loop
Gene family MIPF0002091; MIR7807
Stem-loop
   -----  c  uc    a    a                g    a    cca  ---uuuc  ----u      a 
5'      gu cu  aacu uaug aaaucucaauuuuggu cuaa uuca   gg       ga     caugug g
        || ||  |||| |||| |||||||||||||||| |||| ||||   ||       ||     |||||| c
3'      ca ga  uuga auac uuuaggguuaaaauca gauu aagu   cc       cu     guacac g
   uuuaa  u  ca    c    g                g    a    -cg  uuuaacu  uauuu      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7807a-5p

Accession MIMAT0032250
Sequence

8 - 

aacuauaugaaaaucucaauu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence rgl-miR7807a-3p

Accession MIMAT0032251
Sequence

108 - 

uugggauuugcauacaguuac

 - 128

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).