Stem-loop sequence rgl-MIR7808

AccessionMI0025462 (change log)
DescriptionRehmannia glutinosa miR7808 stem-loop
Stem-loop
   aua  a    c     --     c g  --guu     --g   uuuaa    c     uacauauucaaacgg cu     ------      cagcauccauguuuccagcaugcaagaggcgaaaacucaagaaaaauuucagaacccuagccuugaagaaa 
5'    uc ucug gucga  auccu c cc     cucau   cac     ucgg acgcu               c  ccccu      uaacag                                                                       a
      || |||| |||||  ||||| | ||     |||||   |||     |||| |||||               |  |||||      ||||||                                                                       u
3'    ag agac uagcu  uagga g gg     gggua   gug     aguc uguga               g  gggga      auuguu                                                                       g
   uga  a    u     cg     a -  aagau     aag   --uug    u     --uuacauuacauua -u     uuaaua      uuaguggugauuaaaugagguaauuagugauuauuuuaggagguuuaguuaccgacguguuuaagagagug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7808

Accession MIMAT0032254
Sequence

292 - 

aaggaugcucgauucagaagaa

 - 313

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).