Stem-loop sequence rgl-MIR7809

AccessionMI0025463 (change log)
DescriptionRehmannia glutinosa miR7809 stem-loop
Stem-loop
   c     u    cau   a  aca           auccuuacacgagacuauugcga 
5'  gucga ggau   ugu cg   gugcagugggg                       g
    ||||| ||||   ||| ||   |||||||||||                       c
3'  uaguu ucug   aca gc   uacguuacccu                       c
   -     -    aac   g  gac           aaaguuggguacuuacuaccuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rgl-miR7809

Accession MIMAT0032255
Sequence

84 - 

ucccauugcaucagcggacaca

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).